rs270514 chr1:234458521 T>C
- Sequence
gttttgtaaatagtttttttggaa[T/C]atagccaacgcctgtttatttagt
- ASB in cell types
- liver ZR-75-1 (invasive ductal carcinoma) VCaP (prostate carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| liver | 0.16 | 0.89 | 1.33 | |||
| ZR-75-1 (invasive ductal carcinoma) | n/a | 1.78 | 5.00 | |||
| VCaP (prostate carcinoma) | 1.35 | -0.24 | 2.00 |
Items per page:
1 – 3 of 3