rs270928 chr2:160783577 A>C
- Sequence
aactaggatgagtcacaacacagc[A/C]ccccctgagaaagcagtgagtctg
- ASB in cell types
- SUM159PT (pleiomorphic breast carcinoma)
- ASB for transcription factors
- CEBPB_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CEBPB_HUMAN | 0.27 | 1.44 | 1.83 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, birth weight