rs2715580 chr15:26261079 A>C
- Sequence
aaagctggaggacttttgctcccc[A/C]aaaagcttgtagcagagccagtgc
- ASB in cell types
- 22RV1 (prostate carcinoma) PANC1 (pancreatic ductal adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 22RV1 (prostate carcinoma) | 1.19 | -0.58 | 1.00 | |||
| PANC1 (pancreatic ductal adenocarcinoma) | -1.78 | 1.93 | 1.50 |
Items per page:
1 – 2 of 2