rs27190 chr16:57084296 C>G
- Sequence
atatcatatgacgtgaagagatgc[C/G]caaaatgacagatcagcatcctgt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte HEK293T (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.20 | 0.67 | 1.80 | |||
| foreskin keratinocyte | n/a | 0.90 | 2.00 | |||
| HEK293T (embryonic kidney) | 0.93 | -0.04 | 2.00 | |||
| GM12878 (female B-cells) | 0.52 | 0.40 | 1.30 | |||
| uterus | 1.32 | -0.43 | 1.33 |
Items per page:
1 – 5 of 5