rs2720660 chr8:128048996 A>G
- Sequence
aaataaattacccttctccactgg[A/G]ctctgtgttctgcagccagccata
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN HDAC2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | 1.88 | -2.36 | 2.00 | n/a | No Hit | |||
| HDAC2_HUMAN | 1.84 | -0.80 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP college completion, end-stage renal disease, hdl cholesterol, serum creatinine, systolic blood pressure (sbp), years of education