rs2721933 chr8:115614948 T>C
- Sequence
gatctataaactcatacaattaaa[T/C]ctgttgaaaatacaaatccaaagg
- ASB in cell types
- monocyte-derived dendritic cells
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| monocyte-derived dendritic cells | n/a | 2.24 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP body mass index (bmi), fasting blood glucose, hdl cholesterol, hdl cholesterol change with statins, height, homa-ir, ldl cholesterol