rs272564 chr1:44546601 A>C
- Sequence
cctaatgctgtaaaaggcaagcag[A/C]ccacatcagaggagccctgcgtta
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- FEZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FEZF1_HUMAN | 2.25 | n/a | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
EMBL-EBI heart rate increase in response to exercise, heart rate response to exercise, heart rate response to recovery post exercise, heart rate response to recovery post exercise (30 sec), heart rate response to recovery post exercise (40 sec), heart rate response to recovery post exercise (50 sec), resting heart rate
GRASP 2 hour glucose, asthma, irritible bowel syndrome, ldl cholesterol, rheumatoid arthritis, triglycerides