rs2726103 chr7:36196000 T>C
- Sequence
tccactacacacctagactatata[T/C]ggtatggcctattgctcctaagct
- ASB in cell types
- HepG2 (hepatoblastoma) ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.78 | 0.32 | 2.05 | n/a | No Hit |
Items per page:
1 – 1 of 1