rs273504 chr19:18104437 A>G
- Sequence
agcagctgaagtcaggcctggggt[A/G]acgccacacccccgcgacccttcc
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
- ASB for transcription factors
- CREB1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CREB1_HUMAN | 1.36 | 1.90 | 1.62 | 7.83 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
