rs27390 chr5:56270700 T>C
- Sequence
tggccatccctgaggtgcaatgca[T/C]gacagcagccagtgggggtcagag
- ASB in cell types
- CD34+ hematopoietic stem cells CD34+ stem cells-derived erythroblasts human villous mesenchymal fibroblast cells HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CD34+ hematopoietic stem cells | 2.55 | n/a | 2.00 | |||
| CD34+ stem cells-derived erythroblasts | 1.20 | n/a | 2.50 | |||
| human villous mesenchymal fibroblast cells | 2.41 | -3.55 | 2.00 | |||
| HepG2 (hepatoblastoma) | 0.49 | 0.39 | 1.24 | |||
| GM12878 (female B-cells) | -0.20 | 1.71 | 1.22 |
Items per page:
1 – 5 of 5