rs274069 chr16:24887829 T>C
- Sequence
gatataatttgcaagtggcacata[T/C]aaaacaaagtataacataaggcaa
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN507_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN507_HUMAN | n/a | 2.97 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, obesity with early age of onset (age >2), total cholesterol change with statins
GTEx eQTL Adipose_Visceral_Omentum, Breast_Mammary_Tissue, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid, Whole_Blood