rs2742417 chr3:45689959 C>T
- Sequence
ttttgcttacagcctatctgggta[C/T]cgaagcctgcctgccccctcttca
- ASB in cell types
- HEK293T (embryonic kidney) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293T (embryonic kidney) | -1.02 | 1.35 | 2.75 | |||
| GM12878 (female B-cells) | 0.50 | 0.29 | 1.29 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP diastolic blood pressure (dbp), homa-b, salmonella-induced pyroptosis, sexual side effects in response to antidepressant treatment therapy with bupropion, systolic blood pressure (sbp)
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Cerebellum, Brain_Cortex, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid