rs27555 chr5:34929263 T>G
- Sequence
cacactgaccgccatctgtgcccc[T/G]cacaatgacaccagcgtggccctg
- ASB in cell types
- HEK293 (embryonic kidney) GM12878 (female B-cells) HepG2 (hepatoblastoma) SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 1.18 | -0.49 | 2.85 | |||
| GM12878 (female B-cells) | 0.43 | 0.56 | 1.29 | |||
| HepG2 (hepatoblastoma) | 0.28 | 0.58 | 1.26 | |||
| SK-N-SH (neuroblastoma) | -0.07 | 1.12 | 1.44 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Tibial, Brain_Cortex, Colon_Sigmoid, Colon_Transverse, Esophagus_Mucosa, Esophagus_Muscularis, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Testis, Thyroid