rs27634 chr5:116359380 G>A
- Sequence
agattgcacagctcataagaggtg[G/A]aactggaatttgaggttatatctg
- ASB in cell types
- K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.74 | -0.15 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP eye color, neuroblastoma (brain cancer), obesity with early age of onset (age >2), partial epilepsy, serum creatinine, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Brain_Cerebellum, Brain_Spinal_cord_cervical_c-1, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Pancreas, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid