rs280043 chr17:33664173 T>C
- Sequence
gatagactccgcctcctctgacct[T/C]agggcccttacacatgttgcttgc
- ASB in cell types
- cranial neural crest cells
- ASB for transcription factors
- COT1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| COT1_HUMAN | 2.00 | n/a | 2.00 | 0.40 | Weak Discordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP advanced age-related macular degeneration (geographic atrophy), irritible bowel syndrome, ldl cholesterol, partial epilepsy, schizophrenia, taste change in healthy volunteers in response to topiramate treatment (less carbonation), tetrology of fallot