rs2808019 chr1:220271583 G>A
- Sequence
ttttagttcctaatgtagattctc[G/A]ttcacttcctgacaggttattttc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.47 | 0.95 | 2.63 | |||
| HEK293 (embryonic kidney) | 0.55 | -0.25 | 2.02 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP irritible bowel syndrome, microalbuminuria, partial epilepsy, sporadic creutzfeldt-jakob disease, urinary albumin-to-creatinine ratio, years of education
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Lung, Minor_Salivary_Gland, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg