rs2820464 chr1:219519878 G>A
- Sequence
tcccttctggctcagattgcattc[G/A]tagatataattatttgtttaacat
- ASB in cell types
- ZR-75-1 (invasive ductal carcinoma)
- ASB for transcription factors
- FOXA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| FOXA1_HUMAN | 0.58 | 1.64 | 3.67 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, bipolar disorder, fasting insulin, hdl cholesterol, height, homa-b, homa-ir, infant head circumference, ldl cholesterol, triglycerides, waist hip ratio, waist hip ratio tails (upper and lower 5th percentiles)
GTEx eQTL Adrenal_Gland, Kidney_Cortex, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis