rs283122 chr5:32093457 T>C
- Sequence
tagtcccgccgttgccctgaaata[T/C]ggtggacccctgaacaacatgagg
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte epidermal keratinocytes
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.53 | 0.46 | 1.40 | |||
| foreskin keratinocyte | 0.63 | n/a | 2.17 | |||
| epidermal keratinocytes | 1.18 | -0.42 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, college completion, diabetic retinopathy in type 2 diabetes mellitus, diastolic blood pressure (dbp), fasting blood glucose, hdl cholesterol, resistance to kuru in aged women despite likely exposure, rheumatoid arthritis, triglycerides