rs2834364 chr21:34040267 G>A
- Sequence
tagagctcctcaaggcccattctc[G/A]gagaattgtcattatttgacctct
- ASB in cell types
- liver
- ASB for transcription factors
- HNF4A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| HNF4A_HUMAN | -1.59 | 1.88 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (males)