rs283452 chr5:154506520 A>G
- Sequence
ttccacgtgagcacagattgcagc[A/G]tggggaaccacttccccagcattg
- ASB in cell types
- ICN12 (primary pre-B acute lymphomablastic leukemia)
- ASB for transcription factors
- PBX1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PBX1_HUMAN | 1.73 | -1.38 | 1.33 | n/a | No Hit |
Items per page:
1 – 1 of 1