rs28364579 chr18:49460653 C>G
- Sequence
gcggcgagagaagagggaagcgac[C/G]gagaacgcggctagggaccagacc
- ASB in cell types
- breast tumor tissue spleen
- ASB for transcription factors
- ESR1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 2.32 | n/a | 2.50 | n/a | No Hit | |||
| CTCF_HUMAN | 0.19 | 0.73 | 1.25 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Heart_Atrial_Appendage, Lung, Nerve_Tibial, Testis, Whole_Blood