rs28365916 chr2:230416076 T>C
- Sequence
gccacatttcagaaaagctgagaa[T/C]cccttggagtgaaaaaggaggaga
- ASB in cell types
- GM12878 (female B-cells) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells) | -1.20 | 1.67 | 1.50 | |||
| HepG2 (hepatoblastoma) | 1.18 | -0.30 | 2.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Muscle_Skeletal, Nerve_Tibial, Pituitary, Testis