rs28372890 chr12:12350585 C>A
- Sequence
tgtcaaacagtacaaaaatagaca[C/A]agagacaagtctacccctcacccc
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.28 | 0.90 | 2.00 | |||
| foreskin keratinocyte | 1.30 | -0.71 | 2.25 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg