rs2838412 chr21:43829625 A>T
- Sequence
aactgaggttatcaccacacttct[A/T]ctcaaacgggaacattctccacaa
- ASB in cell types
- K562 (myelogenous leukemia) foreskin keratinocyte SK-N-SH (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.46 | 0.50 | 1.32 | |||
| foreskin keratinocyte | 1.03 | -3.16 | 2.50 | |||
| SK-N-SH (neuroblastoma) | -0.41 | 1.42 | 1.33 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Pancreas, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Small_Intestine_Terminal_Ileum, Stomach, Testis, Thyroid, Whole_Blood