rs28418546 chr4:172202558 A>T
- Sequence
tgagatggatatatagataattat[A/T]ttgggtagaaagattaaaaaatag
- ASB in cell types
- foreskin keratinocyte neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -0.58 | 1.56 | 2.17 | |||
| neural cell | 0.70 | -0.31 | 1.22 |
Items per page:
1 – 2 of 2