rs28429165 chr2:183038483 G>A
- Sequence
acgaggccgcttcccgcagccccg[G/A]acgggccctcggtcacctgatcgg
- ASB in cell types
- foreskin keratinocyte transverse colon GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | n/a | 0.81 | 2.50 | |||
| transverse colon | -0.19 | 1.13 | 1.28 | |||
| GM12878 (female B-cells) | 0.59 | 0.46 | 1.27 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Breast_Mammary_Tissue, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Testis, Thyroid, Whole_Blood