rs28448519 chr16:11346126 C>T
- Sequence
tgtcctgggaaacttctgctcatc[C/T]ttaacgtctcagctcaaatgtgcc
- ASB in cell types
- K562 (myelogenous leukemia) HEK293 (embryonic kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | -0.22 | 0.72 | 2.00 | |||
| HEK293 (embryonic kidney) | -0.15 | 0.46 | 1.90 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Transverse, Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood