rs2846766 chr18:865027 C>A
- Sequence
ccgctcgccgtggtgcttccaggc[C/A]gggaaacgttaccgcagagagaac
- ASB in cell types
- neural cell foreskin keratinocyte HeLa Kyoto (cervical adenocarcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural cell | 0.42 | 0.52 | 1.00 | |||
| foreskin keratinocyte | n/a | 0.41 | 2.50 | |||
| HeLa Kyoto (cervical adenocarcinoma) | 0.77 | -0.58 | 2.00 |
Items per page:
1 – 3 of 3