rs28490548 chr14:69818943 G>A
- Sequence
gtcccttaggtgcagggcaatccc[G/A]tcagcggtgtttggggaggcgggg
- ASB in cell types
- foreskin keratinocyte OCI-LY7 (diffuse large B-cell lymphoma) MCF10CA1a (breast metastatic epithelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.60 | n/a | 2.17 | |||
| OCI-LY7 (diffuse large B-cell lymphoma) | 1.04 | -0.88 | 1.11 | |||
| MCF10CA1a (breast metastatic epithelial cells) | -1.50 | 1.84 | 1.33 |
Items per page:
1 – 3 of 3