rs28515814 chr21:10721223 C>G
- Sequence
aaccacattccattcccctccatt[C/G]cattccattccactcactccattc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.79 | 1.45 | 3.33 | |||
| HepG2 (hepatoblastoma) | -0.86 | 1.63 | 3.83 |
Items per page:
1 – 2 of 2