rs28516418 chr21:10662862 C>T
- Sequence
attcctttccattccattcaagtc[C/T]attccactccattccattctagtc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.71 | 1.28 | 3.18 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.64 | 0.91 | 3.27 |
Items per page:
1 – 2 of 2