rs28553894 chr10:73730085 C>A
- Sequence
tgaaaccgaacagctgtgtgattt[C/A]cgaggttatgttgcttctctacta
- ASB in cell types
- K562 (myelogenous leukemia) GM12878 (female B-cells) A549 (lung carcinoma)
- ASB for transcription factors
- MNT_HUMAN NR2C1_HUMAN COT1_HUMAN KDM1A_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| MNT_HUMAN | 1.64 | -0.16 | 1.21 | n/a | n/a | |||
| NR2C1_HUMAN | 1.85 | -0.97 | 1.33 | n/a | No Hit | |||
| COT1_HUMAN | 1.28 | -0.89 | 1.33 | n/a | No Hit | |||
| KDM1A_HUMAN | 1.62 | -0.95 | 1.33 | n/a | n/a | |||
| RFX1_HUMAN | 1.28 | -0.38 | 1.33 | n/a | No Hit |
Items per page:
1 – 5 of 12
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hypothalamus, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Cells_EBV-transformed_lymphocytes, Colon_Sigmoid, Colon_Transverse, Esophagus_Gastroesophageal_Junction, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Liver, Lung, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid, Whole_Blood