rs286235 chr19:11798793 C>A
- Sequence
ctgggtggaaccaacaggatcctg[C/A]tgtggcgggacccaggcctccgct
- ASB in cell types
- spleen foreskin keratinocyte
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| spleen | 1.62 | -1.44 | 1.00 | |||
| foreskin keratinocyte | 1.76 | -0.05 | 3.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood