rs286262 chr19:11736800 G>A
- Sequence
tcacttgggacatctcccacccca[G/A]tgctgctcactgaactgctgagta
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- PKNX1_HUMAN NCOR1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| PKNX1_HUMAN | n/a | 2.35 | 2.00 | n/a | No Hit | |||
| NCOR1_HUMAN | -0.56 | 1.73 | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP familial hypercholesterolemia, familial hypercholesterolemia (ldl receptor mutation present), infant head circumference, irritible bowel syndrome, microalbuminuria, parkinsons disease
GTEx eQTL Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Small_Intestine_Terminal_Ileum