rs286607 chr5:155063509 C>A
- Sequence
gattgccctctggtaagaattgta[C/A]gctcaattggattttgaaggtcat
- ASB in cell types
- cranial neural crest cells
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| cranial neural crest cells | -1.55 | 2.09 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, prop taste detection threshold, serum creatinine, simpson-angus scale, tardive dyskinesia, total cholesterol, waist hip ratio
GTEx eQTL Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Esophagus_Muscularis, Lung, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Whole_Blood