rs28671076 chr12:132342411 A>G
- Sequence
cgaggccggcagtgtcccctcagg[A/G]gagtcctgccctctgcaggtgatt
- ASB in cell types
- HEK293 (embryonic kidney) MCF10A (breast epithelial cells) SK-N-AS (neuroblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | -0.19 | 0.84 | 2.00 | |||
| MCF10A (breast epithelial cells) | 1.84 | -1.73 | 1.33 | |||
| SK-N-AS (neuroblastoma) | 2.17 | -3.00 | 2.00 |
Items per page:
1 – 3 of 3
Motif analysis
No data available
Genetic associations
GTEx eQTL Brain_Anterior_cingulate_cortex_BA24, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Putamen_basal_ganglia, Thyroid