rs2871865 chr15:98651667 C>G
- Sequence
ggagcgttcttcttgaaggatatt[C/G]tttgtgcaagacggcgatttttga
- ASB in cell types
- HEK293 (embryonic kidney) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.75 | -0.08 | 1.89 | |||
| MCF7 (Invasive ductal breast carcinoma) | 0.23 | 0.46 | 1.40 |
Items per page:
1 – 2 of 2