rs28737345 chr8:133216054 A>G
- Sequence
catcacacacatatgtgcccacac[A/G]tgcacaaacacaactcactagtgc
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 0.70 | 0.08 | 1.64 | |||
| GM12878 (female B-cells) | 0.60 | 0.29 | 1.33 |
Items per page:
1 – 2 of 2