rs28821332 chr21:10735172 G>C
- Sequence
cattgcattccattgcattccatt[G/C]cattccattccattccattcgtgt
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.64 | 0.93 | 3.93 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.72 | 1.06 | 3.38 |
Items per page:
1 – 2 of 2