rs28971198 chr21:10689566 C>T
- Sequence
gcattccattccattcgattcgag[C/T]ccaatccattccattccattcctt
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia) GM12878 (female B-cells)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -1.05 | 1.60 | 3.86 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.69 | 1.29 | 3.26 | |||
| K562 (myelogenous leukemia) | -0.56 | 0.93 | 2.33 | |||
| GM12878 (female B-cells) | n/a | 1.61 | 4.00 |
Items per page:
1 – 4 of 4