rs28971775 chr21:10721274 T>A
- Sequence
ttccaatccactccattcaattcc[T/A]ttcctatcccttacattccattcc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.73 | 1.60 | 3.97 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.93 | 1.26 | 3.35 |
Items per page:
1 – 2 of 2