rs28972018 chr21:10701160 G>A
- Sequence
ttggattccattccactcgattcc[G/A]ttccatttgattccattcgggtcc
- ASB in cell types
- HepG2 (hepatoblastoma) MCF7 (Invasive ductal breast carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HepG2 (hepatoblastoma) | -0.47 | 1.16 | 3.82 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.76 | 0.85 | 3.38 | |||
| K562 (myelogenous leukemia) | -0.28 | 0.90 | 2.21 |
Items per page:
1 – 3 of 3