rs28972315 chr21:10726374 A>C
- Sequence
cattcgattacattacattcgatt[A/C]cattccattctattcccttgtatt
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HepG2 (hepatoblastoma)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | -0.70 | 0.97 | 3.27 | |||
| HepG2 (hepatoblastoma) | -0.89 | 1.15 | 3.77 |
Items per page:
1 – 2 of 2