rs290805 chr7:130735197 T>C
- Sequence
tttttctttttaaaaatgtaaaac[T/C]acatagaaaaacaaacaggataat
- ASB in cell types
- A549 (lung carcinoma) K562 (myelogenous leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| A549 (lung carcinoma) | 1.43 | 0.33 | 1.88 | |||
| K562 (myelogenous leukemia) | 0.51 | 0.15 | 1.51 |
Items per page:
1 – 2 of 2