rs291689 chr20:33416168 T>C
- Sequence
caagtgacctgtgaatcaccagtt[T/C]ttgcctcatgggggcaggcaagag
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) HEK293 (embryonic kidney) RH4 (alveolar rhabdomyosarcoma) MM1.S (plasma cell myeloma)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 (Invasive ductal breast carcinoma) | 1.06 | -0.35 | 1.51 | |||
| HEK293 (embryonic kidney) | -0.14 | 1.09 | 1.97 | |||
| RH4 (alveolar rhabdomyosarcoma) | n/a | 3.12 | 4.00 | |||
| MM1.S (plasma cell myeloma) | 1.21 | -0.00 | 1.33 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Coronary, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Hippocampus, Brain_Hypothalamus, Brain_Putamen_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Brain_Substantia_nigra, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid