rs29180 chr18:9971777 G>T
- Sequence
atataagagtttgtttttccagta[G/T]aaaattaggctaattacagtgata
- ASB in cell types
- epithelial cell of prostate
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| epithelial cell of prostate | 1.10 | -1.00 | 1.00 |
Items per page:
1 – 1 of 1