rs2919846 chr19:44685741 G>C
- Sequence
ggcgtggtggcgggtgcctgtaat[G/C]ccagctactggagaggcagaggca
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | n/a | 1.80 | 2.50 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Pituitary, Thyroid