rs2920194 chr4:4324468 C>G
- Sequence
agacaaagagacacagaaacattc[C/G]gagcctgtgataagctctcccacc
- ASB in cell types
- CD34+ bone marrow cell-derived erythroid progenitors
- ASB for transcription factors
- TAL1_HUMAN GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| TAL1_HUMAN | n/a | 2.02 | 1.50 | 0.66 | Weak Concordant | |||
| GATA1_HUMAN | -1.63 | 1.42 | 1.50 | 0.69 | Weak Concordant |
Items per page:
1 – 2 of 2
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Colon_Transverse, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Prostate, Thyroid, Whole_Blood