rs2922484 chr8:133705164 G>T
- Sequence
gaatccgcttgcttgacttcattg[G/T]gccctgtccagcactgaaatttct
- ASB in cell types
- HL-60 (acute myeloid leukemia) K562 (myelogenous leukemia) HEK293 (embryonic kidney)
- ASB for transcription factors
- REST_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| REST_HUMAN | 1.60 | -0.89 | 1.53 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP hdl cholesterol, height, obesity with early age of onset (age >2), triglycerides change with statins