rs292587 chr7:135200961 A>G
- Sequence
ctacccagaaaacacgccctcata[A/G]cacagaaatcccagaatgaaagac
- ASB in cell types
- HEK293 (embryonic kidney)
- ASB for transcription factors
- GLIS1_HUMAN ZN394_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GLIS1_HUMAN | n/a | 1.87 | 2.00 | n/a | n/a | |||
| ZN394_HUMAN | -2.02 | 2.08 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Tibial, Esophagus_Mucosa, Liver, Lung, Muscle_Skeletal, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Spleen, Stomach, Testis, Thyroid